Frequently Asked Questions For TurboGFP tagged HAP1 Cell Lines

Here you'll find a complete list of all our most frequently asked questions relating to TurboGFP tagged HAP1.

• Do you know if the tag has affected the function or localization of the protein?
• What strategy is used to tag the cells?
• The signal intensity of the tag is very low, why is this?
• Is there anything that can be done to increase the signal?
• Are WT cell lines available to prove that the signal is specific?
• Is TurboGFP light sensitive - is it easily bleached during sampling?
• Can I buy the tagging plasmid to recapitulate the tag in my own cell lines?
• Are there other tags available?
• Are all the proteins tagged for the particular gene, i.e. are there any untagged alleles?
• Do you have a protocol for fixing these cells?
• How many passages can I use these cells?
• Does the intensity of the tag change over time in culture?
• When can I expect the TurboGFP to become visible?
• What applications do you recommend for the TurboGFP tag?
• What is the size and sequence of TurboGFP?
• What are the activation and emission spectrums for TurboGFP?
• Are there any culturing conditions that I have to be aware of that may compromise the functionality (intensity) of the Green Fluorescent Protein tag, eg serum free or high serum media?
• I would like to do co-localization studies with an antibody for another protein. How should I fix the cell lines?
• Which other fluorescent dyes would work well with TurboGFP for co-localization studies

Do you know if the tag has affected the function or localization of the protein?

TurboGFP has been a widely used fluorescent marker and in many cases adding a TurboGFP tag will not affect function or localization of the protein. However, in some cases the tag could interfere with function or localization of the protein by affecting protein folding, for example. To help prevent this from occurring, we include a short linker peptide between the target protein and the TurboGFP tag.

What strategy is used to tag the cells?

We insert the desired tag using a homology-independent strategy we published in Nature Communications. In this strategy the target gene is cleaved at the site where the tag will be integrated using Cas9 programmed with a gRNA. The tag is the inserted via non-homologous end joining at the site where the gRNA cleaved. For more information, please see: A generic strategy for CRISPR-Cas9-mediated gene tagging doi: 10.1038/ncomms10237

The signal intensity of the tag is very low, why is this?

Since the TurboGFP tag is incorporated at the endogenous locus, the intensity of the signal depends on the expression level of the gene being tagged.

Is there anything that can be done to increase the signal?

One strategy to amplify the signal is to fix the cells and do an immune-fluorescence assay using a TurboGFP antibody.

Are WT cell lines available to prove that the signal is specific?

Yes. A vial of Hap1 WT cells will be included at no additional cost.

Is TurboGFP light sensitive - is it easily bleached during sampling

TurboGFP has high photostability and should not be easily bleached.

Can I buy the tagging plasmid to recapitulate the tag in my own cell lines?

No, the tagging plasmid is not provided as a product.

Are there other tags available?

Yes, Turbo RFP, NanoLuc and Halo tags are also available.

Are all the proteins tagged for the particular gene, i.e. are there any untagged alleles?

The editing process ensures that all proteins are tagged, there are no untagged alleles.

Do you have a protocol for fixing these cells?

Yes, simply complete our request form for the GFP visualization protocol

How many passages can I use these cells?

We recommend to keep the cells in culture for approximately 15 passages.

Does the intensity of the tag change over time in culture?

The intensity of the tag itself should not change in culture over time. However, if expression levels of the tagged gene change, the intensity of TurboGFP will change accordingly.

When can I expect the TurboGFP to become visible?

TurboGFP has a rapid generation of fluorescent signal in living cells and should be visible as soon after the target gene is expressed.

What applications do you recommend for the TurboGFP tag?

Live cell imaging, studying the function and localization of a protein, western blotting, protein pull down, affinity chromatography, immunocytochemistry and flow cytometry.

What is the size and sequence of TurboGFP?

Molecular weight, kDa 26

Polypeptide length, aa 232

The sequence does not include a start or stop codon.

GAGAGCGACGAGAGCGGCCTGCCCGCCATGGAGATCGAGTGCCGCATCACCGGCACCCTGAACGGCGTGGAGTTCGAGCTGGTGGGCGGCGGAGAGGGCACCCCCGAGCAGGGCCGCATGACCAACAAGATGAAGAGCACCAAAGGCGCCCTGACCTTCAGCCCCTACCTGCTGAGCCACGTGATGGGCTACGGCTTCTACCACTTCGGCACCTACCCCAGCGGCTACGAGAACCCCTTCCTGCACGCCATCAACAACGGCGGCTACACCAACACCCGCATCGAGAAGTACGAGGACGGCGGCGTGCTGCACGTGAGCTTCAGCTACCGCTACGAGGCCGGCCGCGTGATCGGCGACTTCAAGGTGATGGGCACCGGCTTCCCCGAGGACAGCGTGATCTTCACCGACAAGATCATCCGCAGCAACGCCACCGTGGAGCACCTGCACCCCATGGGCGATAACGATCTGGATGGCAGCTTCACCCGCACCTTCAGCCTGCGCGACGGCGGCTACTACAGCTCCGTGGTGGACAGCCACATGCACTTCAAGAGCGCCATCCACCCCAGCATCCTGCAGAACGGGGGCCCCATGTTCGCCTTCCGCCGCGTGGAGGAGGATCACAGCAACACCGAGCTGGGCATCGTGGAGTACCAGCACGCCTTCAAGACCCCGGATGCAGATGCCGGTGAAGAA

What are the activation and emission spectrums for TurboGFP?

Are there any culturing conditions that I have to be aware of that may compromise the functionality (intensity) of the TurboGFP tag, eg serum free or high serum media?

The cells can be cultured the same as wildtype Hap1 cells.

I would like to perform co-localization studies with an antibody for another protein. How should I fix the cell lines?

Individual antibodies can require specific protocols, so it is advisable to follow the protocol from the antibody manufacturer.

Which other fluorescent dyes would work well with TurboGFP for co-localization studies?

TurboGFP can be used in multicolor labeling applications with blue, true-yellow, red, and far-red fluorescent dyes.