KRAS G12S Reference Standard, 50% 1 FFPE curl
The KRAS G12S Reference Standard is a highly-characterized, biologically-relevant quality control material used to assess the performance of assays that detect somatic mutations, such as Sanger and qPCR sequencing assays.
Horizon FFPE standards eliminate the variability associated with patient-derived reference standards, and avoid the hassle of sourcing, characterizing, and documenting your own cell line mixes. The standard is provided at an allelic frequency of 50%, and may be diluted using the corresponding wild type standard to generate a lower allelic frequencies for limit of detection studies and validation of your pre-analytical phase of the workflow. Horizon’s Base-Seq products are all derived from human cell lines. Using a proprietary method of mild fixation and homogenous paraffin embedding, we generate highly-reproducible and consistent FFPE curls. With any commercially available FFPE extraction protocol, our standards yield high molecular weight DNA. This format ensures that they may applied to a wide-range of assays including qPCR, Sanger sequencing, next-generation sequencing, mass array, and more.
With this product you are able to:
- Evaluate of workflow integrity from pre-analytical DNA extraction to post-analytical bioinformatics
- Analyze the sensitivity of your workflow
- Optimize and validate new cancer panels and routinely monitor the performance of your assay
Technical Data
Synonyms: C-Ki-Ras, K-RAS2B, KI-RAS, KRAS2, RASK2
Format: FFPE
DNA Base Change: GGT→AGT
NCBI Reference Assembly SNP: rs121913530
Cosmic ID: COSM517
Fixation Method: 4% Formalin
Section Size: 15µm or 20µm
Cell Density: 3 x 108 cells per block. Approx. 3.5 x 105 cells per section
Expected DNA Yield: ≥ 400 ng using Promega Maxwell LEV Plus Extraction kit
Product Information
Intended Use: For routine performance monitoring (Research Use Only)
Unit Size: 1 FFPE Section per vial
Extractable DNA: ≥ 400 ng per section using Promega Maxwell LEV Plus FFPE DNA Extraction kit
General Information
Allelic Frequency: 50%
Storage: 4˚C
Expiry: See all product shelf life information
Cell Line Background: SW48
Exome sequencing data: Download additional information on variants present in the parental cell lines
Quality Control
Allelic Frequency: Droplet Digital PCR™
Genotype: Sanger sequencing of locus specific PCR
Quality: Agarose gel electrophoresis
Quantification: Quantifluor™
Genotype: KRAS (G12S/+)
Characterization
Chromatogram:
Primers:
|
Primer |
Sequence |
Size |
|
Forward |
GGTGGAGTATTTGATAGTGTATTAACC |
246 |
|
Reverse |
AGAATGGTCCTGCACCAGTAA |
|
|
Sequencing |
AGAATGGTCCTGCACCAGTAA |
-- |