Processing...
Note that the default design settings will generate CRISPR designs for gene knockout. If you wish to view and change the default design parameters, use Advanced Options ➜
PAM relative to target After
Repeat Sequence GUUUUAGAGCUAUGCUGUUUUG
Relative to Guide 3
Target sequence length 20
Cut relative to target 5' start Sense 17 Anti-sense 17
To generate guide options adjust design parameters by launching Advanced Options below.
For help in setting design parameters please reach out to our Scientific Support team.
In some cases, no design results are returned using the default parameters. Below are potential causes and suggestions for modifying the default settings to obtain designs:
In some cases, no crRNA design results are returned using the default parameters. Below are examples of why the default settings may return no crRNA designs, and suggestions for obtaining designs:
The CRISPR Design Tool service is experiencing high traffic. Please try again.
The CRISPR Design Tool has timed out while working on your gene. Please try your design again in a few minutes. If timeouts persist, please contact Dharmacon Technical Support.
Please try again in a few minutes. If problem persists, contact Technical Support.