Enter name

Please enter identifier for custom DNA sequence CRISPR designs.

Enter a DNA sequence

Enter (or copy and paste) a DNA sequence against which crRNAs are to be designed. Use only A, C, T or G. Maximum sequence length = 10,000 bases.

Enable Specificity Check

Note that the default design settings will generate CRISPR designs for gene knockout. If you wish to view and change the default design parameters, use Advanced Options ➜

PAM relative to target After

Repeat Sequence GUUUUAGAGCUAUGCUGUUUUG

Relative to Guide 3

Target sequence length 20

Cut relative to target 5' start Sense  17 Anti-sense 17

No Guide RNA Found

To generate guide options adjust design parameters by launching Advanced Options below.

For help in setting design parameters please reach out to our Scientific Support team.

In some cases, no design results are returned using the default parameters. Below are potential causes and suggestions for modifying the default settings to obtain designs:

  • Your gene may have non-overlapping transcripts. The default CRISPR Design Tool settings require targeting of all transcripts. In Advanced Options, specific transcripts may be Excluded or Allowed, rather than Required, to loosen the design criteria.
  • You might be using protein-coding gene settings with a noncoding gene target. Go back to the Design Purpose and select: Long non-coding RNA locus.
  • Your gene does not contain a NGG PAM. In Advanced Options, try including NAG PAM or uncheck ?Require cuts to be in CDS?.
  • All potential target sites have GC percentages outside the default parameters. In Advanced Options, expand the GC Percentage settings.
  • Your gene does not contain target sites with more than two mismatches to PAM-adjacent sites in the selected genome. Deselect the Specificity Check. Keep in mind that the designs without Specificity Check are very likely to off-target.

In some cases, no crRNA design results are returned using the default parameters. Below are examples of why the default settings may return no crRNA designs, and suggestions for obtaining designs:

  • Your DNA sequence does not contain a NGG PAM. In advanced options, try including NAG PAM.
  • Your DNA sequence has target sites with GC percentages outside the default parameters. In Advanced Options, expand the default GC Percentage settings.
  • Your DNA sequence only contains target sites that have possible off-targets to the selected genome. Expand the provided DNA sequence or deselect the Specificity Check.

The CRISPR Design Tool service is experiencing high traffic. Please try again.

The CRISPR Design Tool has timed out while working on your gene. Please try your design again in a few minutes. If timeouts persist, please contact Dharmacon Scientific Support.

Please try again in a few minutes. If problem persists, contact Scientific Support.