NRAS Wild Type Reference Standard 5 ug
The NRAS Wild Type Reference Standard is a highly-characterized, biologically-relevant quality control material used to assess the performance of assays that detect somatic mutations, such as Sanger and qPCR sequencing assays.
Horizon DNA standards eliminate the variability associated with patient-derived reference standards, and avoid the hassle of sourcing, characterizing, and documenting your own cell line mixes. The standard may be used to dilute corresponding variant standard to generate lower allelic frequencies for limit of detection studies.Horizon’s Base-Seq products are all derived from human cell lines, and are high molecular weight DNA. This format ensures that they may be applied to a wide-range of assays including qPCR, Sanger sequencing, next-generation sequencing, mass array, and more.
With this product you are able to:
- Analyze the sensitivity of your assay
- Gain certainty of the limit of detection
- Optimize and validate new cancer panels and routinely monitor the performance of your assay
Technical Data
Synonyms: N-Ras
Format: Genomic DNA
Buffer: Tris-EDTA (10mM Tris-HCl, 1mM EDTA), pH 8.64
Product Information
Intended Use: For routine performance monitoring (Research Use Only)
Unit Size: 5µg
Concentration: 50ng/µl
General Information
Allelic Frequency: 100%
Storage: 4˚C
Expiry: See all product shelf life information
Cell Line Background: SW48
Exome sequencing data: Download additional information on variants present in the parental cell lines
Quality Control
Allelic Frequency: Droplet Digital PCR™
Genotype: Sanger sequencing of locus specific PCR
Quality: Agarose gel electrophoresis
Quantification: Spectrophotometry (A260)
Genotype: NRAS (+/+)
Characterization
Gel Image:
Chromatogram:
Primers:
|
Primer |
Sequence |
Size |
|
Forward |
GCTTATTTAACCTTGGCAATAGCA |
521 |
|
Reverse |
CCAAGTCATTCCCAGTAGCAA |
|
|
Sequencing |
GCTTATTTAACCTTGGCAATAGCA |
-- |