There are no delays on our products or support as a result of COVID-19. If there is a way we can assist you, we are here to help - Contact us

What is the sequence of the TRC eGFP hairpin?

The sequence of the TRC Lentiviral eGFP shRNA positive control (RHS4459) is as follows: TACAACAGCCACAACGTCTAT