COVID-19 impacts us all in unexpected ways - If you're still in the lab or working at home please let us know how we can help - Contact Us

What primer can I use to confirm the sgRNA sequence?

For confirmation of the sgRNA sequence, we recommend the following primer (forward): 5'-GGCCTATTTCCCATGATTC-3'The sgRNA sequence is: GN19GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCG TTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTWhere N19 is your target sequence.