COVID-19 impacts us all in unexpected ways - If you're still in the lab or working at home please let us know how we can help - Contact Us

What is the sequence of the TRC eGFP hairpin?

The sequence of the TRC Lentiviral eGFP shRNA positive control (RHS4459) is as follows: TACAACAGCCACAACGTCTAT