There are no delays on our products or support as a result of COVID-19. If there is a way we can assist you, we are here to help - Contact us

What primer can I use to confirm the sgRNA sequence?

For confirmation of the sgRNA sequence, we recommend the following primer (forward): 5'-GGCCTATTTCCCATGATTC-3'The sgRNA sequence is: GN19GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCG TTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTWhere N19 is your target sequence.