There are no delays on our products or support as a result of COVID-19. If there is a way we can assist you, we are here to help - Contact us

What is the non-silencing control hairpin sequence?

The non-silencing control hairpin sequence is as follows: TGCTGTTGACAGTGAGCGATCTCGCTTGGGCGAGAGTAAGTAGTGAAGCCACAGATGTACTTACTCTCGCCCAAGCGAGAGTGCCTACTGCCTCGGA22mer sense: ATCTCGCTTGGGCGAGAGTAAG22mer antisense: CTTACTCTCGCCCAAGCGAGAGThis sequence does not match any known mammalian genes (had at least 3 or more mismatches against any gene as determined via nucleotide alignment/BLAST of 22mer sense sequence). This is the non-silencing shRNAmir hairpin sequence found in the pSM2, pSMP, pGIPZ, pTRIPZ and pLemiR non-silencing controls.