Synthetic single guide RNA for CRISPR-Cas9 experiments
CRISPR-Cas9 genome editing with a synthetic single guide RNA (sgRNA)
Required components for CRISPR-Cas9 gene editing and synthesis of guide RNA
Sequence structure of a synthetic sgRNA

The CRISPR-Cas9 system allows researchers to quickly edit genes for functional protein knockout in mammalian, fish and plant genomes, among others, and consequently has dramatically transformed biological research. The natural Streptoccocus pyogenes CRISPR-Cas9 system requires three components: 1. Cas9 nuclease, 2. CRISPR RNA (crRNA) comprised of targeting and repeat sequences, and 3. tracrRNA, which hybridizes to the crRNA through its anti-repeat sequence. The crRNA:tracrRNA complex recruits the Cas9 nuclease and cleaves DNA upstream of a protospacer-adjacent motif (PAM). The crRNA and tracrRNA can be linked together with a loop sequence for generation of a chimeric single guide RNA (sgRNA; Hsu et al. 2013). sgRNA can be generated for DNA-based expression or by chemical synthesis. Using patented Dharmacon 2'-ACE chemistry (Scaringe et al. 1998, Scaringe et al. 2004), long RNA can be routinely synthesized with faster coupling rates, higher yields and greater purity and is ideal for generating synthetic sgRNAs.
Sequence structure of single guide RNA
Below is one example of how to design a S. pyogenes sgRNA (Hendel et. al. 2015) for chemical synthesis:
- 20 nucleotide (nt) targeting sequence (shown as poly N)
- 12 nt of the crRNA repeat sequence
- 4 nt of tetraloop sequence (underlined)
- 64 nt of tracrRNA sequence
5'- NNNNNNNNNNNNNNNNNNNNGUUUUAGAGCUAGAAA
UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU -3'
Benefits of synthetic sgRNA in gene editing
Although the synthetic two-part RNA (crRNA:tracrRNA) system is efficient and cost-effective for most applications, researchers working with in vivo and ex vivo models have indicated a preference for a sgRNA system. The advantages to using a synthetic sgRNA compared to plasmid-expressed or in vitro transcribed sgRNA include:
- A single oligonucleotide, arrives ready to use
- No cloning, sequencing, or in vitro transcription required
- Options for completely DNA-free gene editing when combined with Cas9 mRNA or Cas9 protein
- Allows for incorporation of chemical modifications
Efficient CRISPR-Cas9 gene editing achieved with synthetic sgRNA and synthetic crRNA:tracrRNA

2'-ACE chemistry was used to synthesize a sgRNA (Hsu et al. 2013, Briner et al. 2014) targeting PPIB, which was then purified by HPLC. A U2OS cell line stably expressing Cas9 nuclease from the CAG promoter was plated at 10,000 cells per well in 96-well format one day prior to transfection. sgRNA (25 nM) or synthetic crRNA:tracrRNA (25 nM) was transfected into duplicate wells using DharmaFECT™ 3 transfection reagent (0.25 μL/well). After 72 hours, direct cell lysis was amplified using primers surrounding the target site on the PPIB gene and gene editing efficiency estimated using a mismatch detection assay (Edit-R™ Synthetic crRNA Positive Controls - Protocol). The synthetic sgRNA for target gene editing resulted in high editing efficiency (data shown are from two experiments; (A), and high editing efficiency was also achieved for synthetic crRNA:tracrRNA (B).
Ordering a synthetic sgRNA
Custom synthetic sgRNAs can be ordered in two ways:
- Use the CRISPR Design Tool to design and order custom synthetic sgRNA in tubes or 96-well plates. For S. pyogenes sgRNA, simply input a 17 to 23 nt targeting sequence. The repeat, loop and tracrRNA sequence as well as our recommended 2xMS nuclease stability modifications will automatically be added. For other Cas9 species and designs, input the entire sgRNA sequence with length ranging between 97-103 nt. All synthetic sgRNAs ordered through the CRISPR Design Tool are verified by MALDI-TOF mass spectrometry for correct identity and purified to result in high editing efficiency.
- Use the Custom single-strand RNA synthesis ordering tool if you require custom modifications or specific purification for your application. The custom single-stranded RNA synthesis tool supports lengths up to 105 nt at the 0.4 µmol synthesis scales with HPLC or PAGE purification options. If you require guaranteed yields above 1 nmol, please contact Technical Support.
Featured Products
-
CRISPR Design Tool
Design and order synthetic sgRNA and crRNA
-
Custom Single-Strand RNA Synthesis
Design and order your synthetic sgRNA
-
CRISPR-Cas9 Gene Editing
Optimized tools for high-confidence genome engineering
-
Cas9 Nuclease
Configure the optimal promoter for your cell type to ensure robust Cas9 expression or explore DNA-free options
-
CRISPR Controls and Detection Primers
Proper controls are essential to assessment of CRISPR-Cas9 genomic editing experiments
Featured Resources
- Dharmacon Edit-R CRISPR Cas9 Gene Editing Products - Brochure
- Edit-R CRISPR-Cas9 Gene Engineering Platform - Video
- Chemical Synthesis of Long and Highly Modified RNA using 2'-ACE Chemistry - Poster
- Additional CRISPR-Cas9 Resources
References:
- Briner, A.E., Donohoue, P.D., et al. , Guide RNA functional modules direct Cas9 activity and orthogonality. Mol Cell. 56(2), 333-339 (2014).
- Hsu, P.D., Scott, D.A., et al., DNA targeting specificity of RNA-guided Cas9 nucleases. Nat. Biotechnol. 31(9), 827-832 (2013).
- Hendel, A, et. al. Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells. Nat.Biotechnol. 33, 985-989 (2015).
- Scaringe, S.A. et al., Novel RNA synthesis method using 5´-silyl-2´-orthoester protecting groups. J. Am. Chem. Soc. 120:11820-11821 (1998).
- Scaringe, S.A. et al., Preparation of 5´-silyl-2´-orthoester ribonucleosides for use in oligoribonucleotide synthesis. Curr. Protoc. Nuc. Acid Chem. 2.10.1-2.10.16 (2004).