EGFR G719S Reference Standard, 5%
The EGFR G719S Reference Standard is a highly-characterized, biologically-relevant quality control material used to assess the performance of assays that detect somatic mutations, such as Sanger and qPCR sequencing assays.
Horizon FFPE standards eliminate the variability associated with patient-derived reference standards, and avoid the hassle of sourcing, characterizing, and documenting your own cell line mixes. The standard is provided at an allelic frequency of 50%, and may be diluted using the corresponding wild type standard to generate a lower allelic frequencies for limit of detection studies and validation of your pre-analytical phase of the workflow. Horizon’s Base-Seq products are all derived from human cell lines. Using a proprietary method of mild fixation and homogenous paraffin embedding, we generate highly-reproducible and consistent FFPE curls. With any commercially available FFPE extraction protocol, our standards yield high molecular weight DNA. This format ensures that they may applied to a wide-range of assays including qPCR, Sanger sequencing, next-generation sequencing, mass array, and more.
With this product you are able to:
- Evaluate of workflow integrity from pre-analytical DNA extraction to post-analytical bioinformatics
- Analyze the sensitivity of your workflow
- Optimize and validate new cancer panels and routinely monitor the performance of your assay
Technical Data
Synonyms
ERBB, ERBB1
Format
FFPE
DNA Base Change
GGC→AGC
NCBI Reference Assembly SNP
rs28929495
Cosmic ID
COSM6252
Fixation Method
4% Formalin
Section Size
15µm or 20µm
Cell Density
3 x 108 cells per block. Approx. 3.5 x 105 cells per section
Expected DNA Yield
≥ 400 ng using Promega Maxwell LEV Plus Extraction kit
Product Information
Intended Use
For routine performance monitoring (Research Use Only)
Unit Size
1 FFPE Section per vial
Extractable DNA
≥ 400 ng per section using Promega Maxwell LEV Plus FFPE DNA Extraction kit
General Information
Allelic Frequency
5%
Storage
4˚C
Expiry
See all product shelf life information
Cell Line Background
RKO
Quality Control
Allelic Frequency
Droplet Digital PCR™
Genotype
Sanger sequencing of locus specific PCR
Quality
Agarose gel electrophoresis
Quantification
Quantifluor™
Genotype
EGFR (G719S/+)
Characterization
Chromatogram

Chromatograph showing heterozygosity for the EGFR G719S mutation within EGFR (SNP accession number: rs28929495)
Primers
Primer |
Sequence |
Size |
Forward |
GCTGAGGTGACCCTTGTCTC |
408 |
Reverse |
GTCAATGGCCCCTTTCATAA |
|
Sequencing |
GCTGAGGTGACCCTTGTCTC |
-- |
Please see our terms and conditions of ordering.
If you need any support, advice or additional documentation then don't hesitate to contact us here. We accept orders using the following methods:
Online:
Our online catalog and ordering system can be used to search our full menu of available Reference Standards. Select your desired reference standards and add them to the shopping basket. Your order can be submitted instantly using credit card, telephone ordering or a purchase order number as the preferred payment method.
Offline:
If you prefer to send us orders outside our online ordering system, please see the Contact Us page for telephone, fax, and email details in order to place an order. We recommend that you use our online system to identify the products you require and their respective “HD” product codes. To order offline we will require the following information:
- Product code(s) of the item(s) you wish to order (e.g. "HD123")
- Your name, email address, title and organization
- Shipping address and billing address with contact names
- Purchase Order number if you have one
- Telephone number
- VAT Number (European Countries only)
Shipping Information
Shipping information for all territories can be found on our Shipping Charges page. This includes Shipping and Handling fees, as well as shipping conditions for each product range.
If you’re having trouble ordering or finding what you’re looking for, or if you require something we don’t yet offer, please contact us.