- Reference standards
- EGFR L858R Reference Standard, 5%
EGFR L858R Reference Standard, 5%
The EGFR L858R Reference Standard is a highly-characterized, biologically-relevant quality control material used to assess the performance of assays that detect somatic mutations, such as Sanger and qPCR sequencing assays.
Horizon FFPE Reference standards are cell-line derived making them reproducible, renewable, and affordable experimental controls for molecular diagnostic assays. They are formulated to mimic patient samples and serve as excellent quality controls by acting as performance indicators for the whole diagnostic workflow.
Technical Information
Horizon FFPE standards eliminate the variability associated with patient-derived reference standards, and avoid the hassle of sourcing, characterizing, and documenting your own cell line mixes. Using a proprietary method of mild fixation and homogenous paraffin embedding, we generate highly reproducible and consistent FFPE curls. Our standards yield high molecular weight DNA which can be analyzed in a wide-range of assays including qPCR, Sanger sequencing and next-generation sequencing.
Product Information
Product Description: EGFR L858R Reference Standard, FFPE, 5%
Catalog number: HD129
Gene: EGFR
Amino Acid Change: L858R
Nucleotide change: c.2573T>G
Variant Allele Frequency: 5%
Cosmic Genomic Mutation ID: COSV51765161
Cosmic Legacy ID: COSM6224
GRCh38 position: 7:55191822
Format: FFPE
Unit Size: 15 µm section
Fixation Method: 4% PFA (w/v)
Expected DNA Yield: ≥ 400ng Using Maxwell RSC Plus FFPE DNA Extraction kit
Storage: 4°C
Shipping: Ambient
Expiry: See all product shelf-life information
Cell Line Background: RKO
Exome Sequencing Data: Download additional sequencing data from the parental cell
Quality Control
Genotype and Allelic Frequency: Droplet Digital PCRTM
DNA integrity: Agarose gel electrophoresis
Quantification: Quantifluor™
Manufacturing Quality: ISO 13485:2016
Use: Research Use Only
Cell Line Characterization
Chromatogram:
Chromatograph showing heterozygosity for the EGFR L858R within EGFR exon 21 (SNP accession number: rs121434568)
Primers:
Primer |
Sequence |
Size |
Forward |
CTCAGAGCCTGGCATGAAC |
346 |
Reverse |
ATCCTCCCCTGCATGTGTTA |
|
Sequencing |
CTCAGAGCCTGGCATGAAC |
-- |
We accept orders using the following methods.
Online
Our online catalog and ordering system can be used to search our full menu of available Reference Standards. Select your desired reference standards and add them to the shopping basket. Your order can be submitted instantly using credit card, telephone ordering or a purchase order number as the preferred payment method.
Offline
If you prefer to send us orders outside our online ordering system, please see the Contact Us page for telephone, fax, and email details in order to place an order. We recommend that you use our online system to identify the products you require and their respective “HD” product codes.
To order offline we will require the following information:
- Product code(s) of the item(s) you wish to order (e.g. "HD123")
- Your name, email address, title and organization
- Shipping address and billing address with contact names
- Purchase Order number if you have one
- Telephone number
- VAT Number (European Countries only)
Shipping Information
Shipping information for all territories can be found on our Shipping Charges page. This includes Shipping and Handling fees, as well as shipping conditions for each product range.
If you’re having trouble ordering or finding what you’re looking for, or if you require something we don’t yet offer, please contact us.