- Reference standards
- EGFR V769_D770insASV Reference Standard, 50% 1 FFPE curl
EGFR V769_D770insASV Reference Standard, 50% 1 FFPE curl
The EGFR V769_D770insASV Reference Standard is a highly-characterized, biologically-relevant quality control material used to assess the performance of assays that detect somatic mutations, such as Sanger and qPCR sequencing assays.
Horizon FFPE Reference standards are cell-line derived making them reproducible, renewable, and affordable experimental controls for molecular diagnostic assays. They are formulated to mimic patient samples and serve as excellent quality controls by acting as performance indicators for the whole diagnostic workflow.
Technical Information
Horizon FFPE standards eliminate the variability associated with patient-derived reference standards, and avoid the hassle of sourcing, characterizing, and documenting your own cell line mixes. Using a proprietary method of mild fixation and homogenous paraffin embedding, we generate highly reproducible and consistent FFPE curls. Our standards yield high molecular weight DNA which can be analyzed in a wide-range of assays including qPCR, Sanger sequencing and next-generation sequencing.
Product Information
Product Description: EGFR V769_D770insASV Reference Standard, 50% 1 FFPE curl
Catalog number: HD706
Gene: EGFR
Amino Acid Change: V769_D770insASV/A767_V769dup
Nucleotide change: c.2307_2308insGCCAGCGTG/c.2300_2308dup
Variant Allele Frequency: 50%
Cosmic Genomic Mutation ID: COSV51766549
Cosmic Legacy ID: COSM12376
GRCh38 position: 7:55181317-55181318
Format: FFPE
Unit Size: 15 µm section
Fixation Method: 4% PFA (w/v)
Expected DNA Yield: ≥ 400ng Using Maxwell RSC Plus FFPE DNA Extraction kit
Storage: 4°C
Shipping: Ambient
Expiry: See all product shelf-life information
Cell Line Background: RKO
Exome Sequencing Data: Download additional sequencing data from the parental cell
Quality Control
Genotype and Allelic Frequency: Droplet Digital PCRTM
DNA integrity: Agarose gel electrophoresis
Quantification: Quantifluor™
Manufacturing Quality: ISO 13485:2016
Use: Research Use Only
Cell Line Characterization
Chromatogram:
Chromatograph showing heterozygosity for the EGFR V769-D770insASV mutation within EGFR
Primers:
Primer |
Sequence |
Size |
Forward |
CTCTCCCACTGCATCTGTCA |
373 |
Reverse |
ACACACCAGTTGAGCAGGTA |
|
Sequencing |
CTCTCCCACTGCATCTGTCA |
-- |
We accept orders using the following methods.
Online
Our online catalog and ordering system can be used to search our full menu of available Reference Standards. Select your desired reference standards and add them to the shopping basket. Your order can be submitted instantly using credit card, telephone ordering or a purchase order number as the preferred payment method.
Offline
If you prefer to send us orders outside our online ordering system, please see the Contact Us page for telephone, fax, and email details in order to place an order. We recommend that you use our online system to identify the products you require and their respective “HD” product codes.
To order offline we will require the following information:
- Product code(s) of the item(s) you wish to order (e.g. "HD123")
- Your name, email address, title and organization
- Shipping address and billing address with contact names
- Purchase Order number if you have one
- Telephone number
- VAT Number (European Countries only)
If you’re having trouble ordering or finding what you’re looking for, or if you require something we don’t yet offer, please contact us.