- Reference standards
- FLT3 D835Y Reference Standard, 50%
FLT3 D835Y Reference Standard, 50%
The FLT3 D835Y Reference Standard is a highly-characterized, biologically-relevant quality control material used to assess the performance of assays that detect somatic mutations, such as Sanger and qPCR sequencing assays.
Horizon DNA standards eliminate the variability associated with patient-derived reference standards, and avoid the hassle of sourcing, characterizing, and documenting your own cell line mixes. The standard is provided at an allelic frequency of 50%, and may be diluted using the corresponding wild-type standard to generate a lower allelic frequencies for limit of detection studies. Horizon’s Base-Seq products are all derived from human cell lines, and are high molecular weight DNA. This format ensures that they may be applied to a wide-range of assays including qPCR, Sanger sequencing, next-generation sequencing, mass array, and more.
With this product you are able to:
- Analyze the sensitivity of your assay
- Gain certainty of the limit of detection
- Optimize and validate new cancer panels and routinely monitor the performance of your assay
Technical Data
Synonyms: CD135, FLK2, STK1
Format: Genomic DNA
DNA Base Change: GAT→TAT
NCBI Reference Assembly SNP: rs121913488
Cosmic ID: COSM783
Buffer: Tris-EDTA (10mM Tris-HCl, 1mM EDTA), pH 8.27
Product Information
Intended Use: For routine performance monitoring (Research Use Only)
Unit Size: 1µg
Concentration: 50ng/µl
General Information
Allelic Frequency: 50%
Storage: 4˚C
Expiry: See all product shelf life information
Cell Line Background: HCT116
Exome sequencing data: Download additional information on variants present in the parental cell lines
Quality Control
Allelic Frequency: Droplet Digital PCR™
Genotype: Sanger sequencing of locus specific PCR
Quality: Agarose gel electrophoresis
Quantification: Spectrophotometry (A260)
Genotype: FLT3 (D835Y/+)
Characterization
Gel Image:
DNA was run on a 1% agarose gel and shows a single high-molecular weight band
Chromatogram:
Chromatograph showing heterozygosity for the FLT3 D835Y mutation within FLT3 (SNP accession number: rs121913488)
Primers
Primer |
Sequence |
Size |
Forward |
CTTTGTTTGTTGCACATCATCA |
368 |
Reverse |
CACCACAGTGAGTGCAGTTG |
|
Sequencing |
CTTTGTTTGTTGCACATCATCA |
-- |
We accept orders using the following methods.
Online
Our online catalog and ordering system can be used to search our full menu of available Reference Standards. Select your desired reference standards and add them to the shopping basket. Your order can be submitted instantly using credit card, telephone ordering or a purchase order number as the preferred payment method.
Offline
If you prefer to send us orders outside our online ordering system, please see the Contact Us page for telephone, fax, and email details in order to place an order. We recommend that you use our online system to identify the products you require and their respective “HD” product codes.
To order offline we will require the following information:
- Product code(s) of the item(s) you wish to order (e.g. "HD123")
- Your name, email address, title and organization
- Shipping address and billing address with contact names
- Purchase Order number if you have one
- Telephone number
- VAT Number (European Countries only)
Shipping Information
Shipping information for all territories can be found on our Shipping Charges page. This includes Shipping and Handling fees, as well as shipping conditions for each product range.
If you’re having trouble ordering or finding what you’re looking for, or if you require something we don’t yet offer, please contact us.