- Reference standards
- KRAS Wild Type Reference Standard 1 FFPE curl
KRAS Wild Type Reference Standard 1 FFPE curl
The KRAS Wild Type Reference Standard is a highly-characterized, biologically-relevant quality control material used to assess the performance of assays that detect somatic mutations, such as Sanger and qPCR sequencing assays.
Horizon FFPE standards eliminate the variability associated with patient-derived reference standards, and avoid the hassle of sourcing, characterizing, and documenting your own cell line mixes. Using a proprietary method of mild fixation and homogenous paraffin embedding, we generate highly-reproducible and consistent FFPE curls. With any commercially available FFPE extraction protocol, our standards yield high molecular weight DNA. This format ensures that they may applied to a wide-range of assays including qPCR, Sanger sequencing, next-generation sequencing, mass array, and more.
With this product you are able to:
- Evaluate of workflow integrity from pre-analytical DNA extraction to post-analytical bioinformatics
- Analyze the sensitivity of your workflow
- Optimize and validate new cancer panels and routinely monitor the performance of your assay
Product Information
Product Description: KRAS Wild Type Reference Standard
Catalog Number: HD135
Synonyms: C-Ki-Ras, K-RAS2B, KI-RAS, KRAS2, RASK2
Format: FFPE
Fixation Method: 4% PFA (w/v)
Section Size: 15µm
Cell Density: 3 x 108 cells per block. Approx. 3.5 x 105 cells per section
Expected DNA Yield: ≥ 400 ng using Promega Maxwell RSC Plus Extraction kit
Intended Use: Research Use Only
Unit Size: 1 FFPE Section per vial
Extractable DNA: ≥ 400 ng per section using Promega Maxwell RSC Plus FFPE DNA Extraction kit
General Information
Allelic Frequency: WT
Storage: 4˚C
Shipping: Ambient
Expiry: See all product shelf life information
Cell Line Background: SW48
Exome sequencing data: Download additional information on variants present in the parental cell lines
Quality Control
Genotype and Allelic Frequency: Droplet Digital PCR™
DNA Integrity: Agarose gel electrophoresis
Quantification: Quantifluor™
Manufacturing Quality: ISO 13485:2016
Genotype: KRAS (+/+)
Cell Line Characterization
Sanger sequencing of locus specific PCR
Chromatogram:
Chromatograph showing heterozygosity for the KRAS A146T mutation and KRAS A146 wild type
Primers:
Primer |
Sequence |
Size / bp |
Forward |
GGTGGAGTATTTGATAGTGTATTAACC |
246 |
Reverse |
AGAATGGTCCTGCACCAGTAA |
|
Sequencing |
AGAATGGTCCTGCACCAGTAA |
-- |
Quantification |
Quantifluor™ assay (5ng/µl), Nanodrop (50ng/µl) |
Product Sequence - KRAS G12CFor Sanger sequencing of KRAS G12C we use the following primer set:Primer |
Sequence |
Size / bp |
Forward |
GGTGGAGTATTTGATAGTGTATTAACC |
246 |
Reverse |
AGAATGGTCCTGCACCAGTAA |
|
Sequencing |
AGAATGGTCCTGCACCAGTAA |
246 |
Product Sequence - KRAS G12DFor Sanger sequencing of KRAS G12D we use the following primer set:Primer |
Sequence |
Size / bp |
Forward |
GGTGGAGTATTTGATAGTGTATTAACC |
246 |
Reverse |
AGAATGGTCCTGCACCAGTAA |
|
Sequencing |
AGAATGGTCCTGCACCAGTAA |
246 |
Product Sequence - KRAS G12RFor Sanger sequencing of KRAS G12R we use the following primer set:Primer |
Sequence |
Size / bp |
Forward |
GGTGGAGTATTTGATAGTGTATTAACC |
246 |
Reverse |
AGAATGGTCCTGCACCAGTAA |
|
Sequencing |
AGAATGGTCCTGCACCAGTAA |
246 |
Product Sequence - KRAS G12SFor Sanger sequencing of KRAS G12S we use the following primer set:Primer |
Sequence |
Size / bp |
Forward |
GGTGGAGTATTTGATAGTGTATTAACC |
246 |
Reverse |
AGAATGGTCCTGCACCAGTAA |
|
Sequencing |
AGAATGGTCCTGCACCAGTAA |
-- |
Product Sequence - KRAS G12VFor Sanger sequencing of KRAS G12V we use the following primer set:Sequence |
Size / bp |
GGTGGAGTATTTGATAGTGTATTAACC |
246 |
AGAATGGTCCTGCACCAGTAA |
|
AGAATGGTCCTGCACCAGTAA |
Product Sequence - KRAS G13DFor Sanger sequencing of KRAS G13D we use the following primer set:Sequence |
Size / bp |
GGTGGAGTATTTGATAGTGTATTAACC |
246 |
AGAATGGTCCTGCACCAGTAA |
|
AGAATGGTCCTGCACCAGTAA |
Product Sequence - KRAS Q61HFor Sanger sequencing of KRAS Q61H we use the following primer set:Sequence |
Size / bp |
TGTTTTCCACAATGGCATCA |
633 |
TGCATGGCATTAGCAAAGAC |
|
TGCATGGCATTAGCAAAGAC |
Product Sequence - KRAS A146TFor Sanger sequencing of KRAS A146T we use the following primer set:Sequence |
Size / bp |
TTCTTTCCCAGAGAACAAATTAAAA |
190 |
TTATTTCAGTGTTACTTACCTGTCTTG |
|
TTCTTTCCCAGAGAACAAATTAAAA |
We accept orders using the following methods.
Online
Our online catalog and ordering system can be used to search our full menu of available Reference Standards. Select your desired reference standards and add them to the shopping basket. Your order can be submitted instantly using credit card, telephone ordering or a purchase order number as the preferred payment method.
Offline
If you prefer to send us orders outside our online ordering system, please see the Contact Us page for telephone, fax, and email details in order to place an order. We recommend that you use our online system to identify the products you require and their respective “HD” product codes.
To order offline we will require the following information:
- Product code(s) of the item(s) you wish to order (e.g. "HD123")
- Your name, email address, title and organization
- Shipping address and billing address with contact names
- Purchase Order number if you have one
- Telephone number
- VAT Number (European Countries only)
If you’re having trouble ordering or finding what you’re looking for, or if you require something we don’t yet offer, please contact us.