- Reference standards
- NRAS Wild Type Reference Standard 1 FFPE curl
NRAS Wild Type Reference Standard 1 FFPE curl
The NRAS Wild TypeReference Standard is a highly-characterized, biologically-relevant quality control material used to assess the performance of assays that detect somatic mutations, such as Sanger and qPCR sequencing assays.
Horizon FFPE standards eliminate the variability associated with patient-derived reference standards, and avoid the hassle of sourcing, characterizing, and documenting your own cell line mixes. Using a proprietary method of mild fixation and homogenous paraffin embedding, we generate highly-reproducible and consistent FFPE curls. With any commercially available FFPE extraction protocol, our standards yield high molecular weight DNA. This format ensures that they may applied to a wide-range of assays including qPCR, Sanger sequencing, next-generation sequencing, mass array, and more.
With this product you are able to:
- Evaluate of workflow integrity from pre-analytical DNA extraction to post-analytical bioinformatics
- Analyze the sensitivity of your workflow
- Optimize and validate new cancer panels and routinely monitor the performance of your assay
Product Information
Product Description: NRAS Wild Type Reference Standard
Catalog Number: HD322
Synonyms: N-Ras
Format: FFPE
Fixation Method: 4% PFA (w/v)
Section Size: 15µm
Cell Density: 3 x 108 cells per block. Approx. 3.5 x 105 cells per section
Expected DNA Yield: ≥ 400 ng using Promega Maxwell RSC Plus Extraction kit
Intended Use: For routine performance monitoring (Research Use Only)
Unit Size: 1 FFPE Section per vial
Extractable DNA: ≥ 400 ng per section using Promega Maxwell RSC Plus FFPE DNA Extraction kit
General Information
Allelic Frequency: WT
Storage: 4˚C
Shipping: Ambient
Expiry: See all product shelf life information
Cell Line Background: SW48
Exome sequencing data: Download additional information on variants present in the parental cell lines
Quality Control
Genotype and Allelic Frequency: Droplet Digital PCR™
DNA Integrity: Agarose gel electrophoresis
Quantification: Quantifluor™
Manufacturing Quality: ISO 13485:2016
Genotype: NRAS (+/+)
Characterization
Chromatogram:
Primers:
Primer |
Sequence |
Size |
Forward |
GCTTATTTAACCTTGGCAATAGCA |
521 |
Reverse |
CCAAGTCATTCCCAGTAGCAA |
|
Sequencing |
GCTTATTTAACCTTGGCAATAGCA |
-- |
We accept orders using the following methods.
Online
Our online catalog and ordering system can be used to search our full menu of available Reference Standards. Select your desired reference standards and add them to the shopping basket. Your order can be submitted instantly using credit card, telephone ordering or a purchase order number as the preferred payment method.
Offline
If you prefer to send us orders outside our online ordering system, please see the Contact Us page for telephone, fax, and email details in order to place an order. We recommend that you use our online system to identify the products you require and their respective “HD” product codes.
To order offline we will require the following information:
- Product code(s) of the item(s) you wish to order (e.g. "HD123")
- Your name, email address, title and organization
- Shipping address and billing address with contact names
- Purchase Order number if you have one
- Telephone number
- VAT Number (European Countries only)
If you’re having trouble ordering or finding what you’re looking for, or if you require something we don’t yet offer, please contact us.