- Reference standards
- PIK3CA Wild Type Reference Standard 1 FFPE curl
PIK3CA Wild Type Reference Standard 1 FFPE curl
The PIK3CA Wild Type Reference Standard is a highly-characterized, biologically-relevant quality control material used to assess the performance of assays that detect somatic mutations, such as Sanger and qPCR sequencing assays.
Horizon FFPE Reference standards are cell-line derived making them reproducible, renewable, and affordable experimental controls for molecular diagnostic assays. They are formulated to mimic patient samples and serve as excellent quality controls by acting as performance indicators for the whole diagnostic workflow.
Technical Information
Horizon FFPE standards eliminate the variability associated with patient-derived reference standards, and avoid the hassle of sourcing, characterizing, and documenting your own cell line mixes. Using a proprietary method of mild fixation and homogenous paraffin embedding, we generate highly reproducible and consistent FFPE curls. Our standards yield high molecular weight DNA which can be analyzed in a wide-range of assays including qPCR, Sanger sequencing and next-generation sequencing.
Product Information
Synonyms: PI3Kα
Format: FFPE
Fixation Method: 4% PFA (w/v)
Section Size: 15µm
Cell Density: 3 x 108 cells per block. Approx. 3.5 x 105 cells per section
Expected DNA Yield: ≥ 400 ng using Promega Maxwell RSC Plus Extraction kit
Intended Use: Research Use Only
Unit Size: 1 FFPE Section per vial
Extractable DNA: ≥ 400 ng per section using Promega Maxwell RSC Plus FFPE DNA Extraction kit
General Information
Allelic Frequency: WT
Storage: 4˚C
Expiry: See all product shelf life information
Cell Line Background: SW48
Exome sequencing data: Download additional information on variants present in the parental cell lines
Quality Control
Genotype and Allelic Frequency: Droplet Digital PCRTM
DNA integrity: Agarose gel electrophoresis
Quantification: Quantifluor™
Manufacturing Quality: ISO 13485:2016
Use: Research Use Only
Cell Line Characterization
Chromatogram:
Chromatograph showing heterozygosity for the E545K mutation and PIK3CA; wild type
Primers:
Primer |
Sequence |
Size |
Forward |
CTGTGAATCCAGAGGGGAAA |
841 |
Reverse |
CAAAAGGAAAATGCAAATGG |
|
Sequencing |
CTGTGAATCCAGAGGGGAAA |
-- |
PI3Kα E545
For Sanger sequencing of PI3Kα E545 we use the following primer set:
Primer |
Sequence |
Size |
Forward |
CTGTGAATCCAGAGGGGAAA |
841 |
Reverse |
CAAAAGGAAAATGCAAATGG |
|
Sequencing |
CTGTGAATCCAGAGGGGAAA |
-- |
PI3Kα h2047
For Sanger sequencing of PI3Kα h2047 we use the following primer set:
Primer |
Sequence |
Size |
Forward |
CATTTGCTCCAAACTGACCA |
493 |
Reverse |
ATCAAACCCTGTTTGCGTTT |
|
Sequencing |
CATTTGCTCCAAACTGACCA |
-- |
We accept orders using the following methods.
Online
Our online catalog and ordering system can be used to search our full menu of available Reference Standards. Select your desired reference standards and add them to the shopping basket. Your order can be submitted instantly using credit card, telephone ordering or a purchase order number as the preferred payment method.
Offline
If you prefer to send us orders outside our online ordering system, please see the Contact Us page for telephone, fax, and email details in order to place an order. We recommend that you use our online system to identify the products you require and their respective “HD” product codes.
To order offline we will require the following information:
- Product code(s) of the item(s) you wish to order (e.g. "HD123")
- Your name, email address, title and organization
- Shipping address and billing address with contact names
- Purchase Order number if you have one
- Telephone number
- VAT Number (European Countries only)
If you’re having trouble ordering or finding what you’re looking for, or if you require something we don’t yet offer, please contact us.