- Gene modulation
- RNA interference
- miRIDIAN microRNA Mimic Negative Control #2
miRIDIAN microRNA Mimic Negative Control #2
Differentiate between specific and non-specific effects with a negative control mimic
miRIDIAN microRNA Mimic Negative Controls are ideal for optimizing conditions for relevant, well-controlled microRNA modulation experiments. Both positive and negative control molecules are provided for overexpression microRNA studies.
Highlights
- Based on cel-miR-239b, mature sequence:
UUGUACUACACAAAAGUACUG(MIMAT0000295) - Cel-miR-239b confirmed to have minimal sequence identity with miRNAs in human, mouse, and rat
- Identical design and modifications as miRIDIAN microRNA Mimics
- No identifiable effects on tested miRNA function (see Figure 1, Supporting Data)
Applications
- Non-targeting mimics for use as controls in miRNA mimic experiments
- Distinguish between specific mimic activity and background effects
Submit an online quote request for larger quantities of RNAi Controls or siRNA Libraries.
miRIDIAN microRNA Mimic Negative Controls have no apparent effect on tested miRNA function

Figure 1. | Effects of miRIDIAN microRNA Mimic Negative Controls on the function of three human miRNAs were assayed at 24 hours after transfection of 10 nM mimic or negative control in HeLa cells using a dual luciferase reporter system.
Application notes
-
microRNA Mimic and Inhibitor Functional Analysis - Application Note
-
microRNA Targets in Stem Cell Differentiation - Application Note
-
Modulating endogenous miRNA targets with miRIDIAN microRNA mimics and inhibitors - Application Note
-
Screening microRNAs for Determinants of Osteogenesis - Application Note
Protocols
Safety data sheets
Related Products
Choose from two universal miRIDIAN Mimic Negative Controls for experiments with miRIDIAN microRNA Mimics. Negative control sequences based on C. elegans microRNAs have minimal sequence identity in human, mouse, and rat.
The miRIDIAN microRNA Mimic Housekeeping Positive Controls allow for the direct monitoring of housekeeping genes in a microRNA mimic experiment. Positive Control #1 targets PPIB (aka Cyclophilin B).
The miRIDIAN microRNA Mimic Housekeeping Positive Controls allows for direct monitoring of housekeeping genes in a microRNA mimic experiment. Positive Control #2 targets GAPD so experimental conditions may be optimized with a validated mimic control.
The miRIDIAN microRNA Mimic Endogenous Positive Control helps you monitor specific mimic effects on target protein levels in a validated endogenous assay, which is based upon the targeted activity of miR-122 on Aldolase A mRNA levels in cell lines.