miRIDIAN microRNA Hairpin Inhibitor Negative Control #1
Differentiate between specific and non-specific effects with a negative control inhibitor
Choose from two universal miRIDIAN Hairpin Inhibitor Negative Controls for experiments with miRIDIAN microRNA Hairpin Inhibitors. Negative control sequences based on C. elegans microRNAs have minimal sequence identity in human, mouse, and rat.
Loading...
Loading...
miRIDIAN microRNA Hairpin Inhibitor Negative Controls are ideal for optimizing conditions for relevant, well-controlled microRNA modulation experiments. Both positive and negative control molecules are provided for loss-of-function microRNA studies.
Highlights
- Based on cel-miR-67, mature sequence:
UCACAACCUCCUAGAAAGAGUAGA(MIMAT0000039) - Cel-miR-67 confirmed to have minimal sequence identity with miRNAs in human, mouse, and rat
- Identical design and modifications as miRIDIAN microRNA Hairpin Inhibitors
- No identifiable effects on tested miRNA function (see Figure 1, Supporting Data)
Applications
- Non-targeting inhibitors for use as controls in miRNA inhibition experiments
- Distinguish between specific inhibitor activity and background effects
Submit an online quote request for larger quantities of RNAi Controls or siRNA Libraries.
