- Gene modulation
- RNA interference
- miRIDIAN microRNA Hairpin Inhibitor Negative Control #1
miRIDIAN microRNA Hairpin Inhibitor Negative Control #1
Differentiate between specific and non-specific effects with a negative control inhibitor
miRIDIAN microRNA Hairpin Inhibitor Negative Controls are ideal for optimizing conditions for relevant, well-controlled microRNA modulation experiments. Both positive and negative control molecules are provided for loss-of-function microRNA studies.
Highlights
- Based on cel-miR-67, mature sequence:
UCACAACCUCCUAGAAAGAGUAGA(MIMAT0000039)
- Cel-miR-67 confirmed to have minimal sequence identity with miRNAs in human, mouse, and rat
- Identical design and modifications as miRIDIAN microRNA Hairpin Inhibitors
- No identifiable effects on tested miRNA function (see Figure 1, Supporting Data)
Applications
- Non-targeting inhibitors for use as controls in miRNA inhibition experiments
- Distinguish between specific inhibitor activity and background effects
Submit an online quote request for larger quantities of RNAi Controls or siRNA Libraries.
miRIDIAN Hairpin Inhibitor Negative Controls distinguish between miRNA-specific and non-specific effects

Figure 1. | Effects of miRIDIAN microRNA Hairpin Inhibitor Negative Controls on the function of miR-21 were assayed at 48 hours after transfection of 5 nM inhibitor or negative control in H9c2, NIh6T3, or HeLa cells using DharmaFECT Duo and a dual luciferase reporter system.
Shipping Condition | Ambient | |
Storage Conditions | -20 C | |
Stability at Recommended Storage Conditions | At least 12 months | |
Hazardous | No |
Application notes
Protocols
Related Products
Choose from two universal miRIDIAN Hairpin Inhibitor Negative Controls for experiments with miRIDIAN microRNA Hairpin Inhibitors. Negative control sequences based on <em>C. elegans </em>microRNAs have minimal sequence identity in human, mouse, and rat.
miRIDIAN microRNA Hairpin Inhibitor Positive Control targets miR-16 for monitoring the effects of a microRNA inhibitor in a validated, endogenous assay, allowing for microRNA functional assays optimization and hairpin inhibitor function evaluation.
The miRIDIAN microRNA Hairpin Inhibitor Transfection Control is a Cy3-labeled microRNA Hairpin Inhibitor based on the C. elegans miRNA cel-miR-67 (miRIDIAN Hairpin Inhibitor Negative Control #1) for monitoring delivery into human, mouse, and rat cells.